SubtiBank SubtiBank
ywaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywaD

double-zinc aminopeptidase
locus
BSU_38470
pI
6.64
mw
49.29 kDa
protein length
455 aa Sequence Blast
gene length
1368 bp Sequence Blast
function
unknown
product
double-zinc aminopeptidase
essential
no
synonyms
ipa-8r

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,948,555 3,949,922

    The protein

    Catalyzed reaction/ biological activity

  • Release of N-terminal Arg and Lys from oligopeptides when P1' is not Pro. Also acts on arylamides of Arg and Lys (according to UniProt)
  • Release of an N-terminal amino acid, preferentially leucine, but not glutamic or aspartic acids (according to UniProt)
  • Protein family

  • peptidase M28 family (single member, according to UniProt)
  • Structure

  • [PDB|6HC6]
  • [PDB|6HC7]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|162B960244B0E1334F9E99E7E0F050D3312830E5|ywaD]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B678 (ywaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1677 NBRP B. subtilis, Japan]
  • BKE38470 ([gene|162B960244B0E1334F9E99E7E0F050D3312830E5|ywaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAATAAACCTCCCC, downstream forward: _UP4_TAAAAAAAGACGGCACTTGG
  • BKK38470 ([gene|162B960244B0E1334F9E99E7E0F050D3312830E5|ywaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAATAAACCTCCCC, downstream forward: _UP4_TAAAAAAAGACGGCACTTGG
  • References

  • 15668014,23426795,18957862,23787698,24633010,26898926,28257579