SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glutamate-5-semialdehyde dehydrogenase, required for normal and osmoadaptive proline biosynthesis
45.17 kDa
protein length
415 aa Sequence Blast
gene length
1248 bp Sequence Blast
biosynthesis of proline
glutamate-5-semialdehyde dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of proline]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    1,379,605 1,380,852

    Phenotypes of a mutant

  • auxotrophic for proline [Pubmed|21784929]
  • The protein

    Catalyzed reaction/ biological activity

  • L-glutamate 5-semialdehyde + NADP+ + phosphate --> H+ + L-glutamyl 5-phosphate + NADPH (according to UniProt)
  • Protein family

  • gamma-glutamyl phosphate reductase family (single member, according to UniProt)
  • Structure

  • [PDB|1O20] (from ''Thermotoga maritima'', 46% identity, 67% similarity) [Pubmed|14705032]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21233158], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by proline limitation ([SW|T-box]) [Pubmed|21233158]
  • expression requires functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • [protein|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|ProA] is absent from the membrane proteome of a '[protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|BdbC]-[protein|CED818CEF5B573A40F382157375E60C0B331F098|BdbD]' mutant [PubMed|22540663]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE13130 ([gene|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|proA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTTCACTCATTTTTCCGC, downstream forward: _UP4_TAGCGGGGTAATGTTCAATG
  • BKK13130 ([gene|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|proA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTTCACTCATTTTTCCGC, downstream forward: _UP4_TAGCGGGGTAATGTTCAATG
  • References


  • 25367752
  • Original publications

  • 19258532,21233158,22540663,21784929,17562291,23869754,25344233,28752945,30355672