SubtiBank SubtiBank
proA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

proA

glutamate-5-semialdehyde dehydrogenase, required for normal and osmoadaptive proline biosynthesis
locus
BSU13130
pI
5.10
mw
45.17 kDa
protein length
415 aa Sequence Blast
gene length
1248 bp Sequence Blast
function
biosynthesis of proline
product
glutamate-5-semialdehyde dehydrogenase
essential
no
ec
1.2.1.41
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.2|Biosynthesis/ acquisition of proline]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    1,379,605 1,380,852

    Phenotypes of a mutant

  • auxotrophic for proline [Pubmed|21784929]
  • The protein

    Catalyzed reaction/ biological activity

  • L-glutamate 5-semialdehyde + phosphate + NADP+ = L-glutamyl 5-phosphate + NADPH (according to Swiss-Prot)
  • Protein family

  • gamma-glutamyl phosphate reductase family (according to Swiss-Prot)
  • Structure

  • [PDB|1O20] (from ''Thermotoga maritima'', 46% identity, 67% similarity) [Pubmed|14705032]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5592C5163CF024289B850916516E2C8C7AD43136|proB]-[gene|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|proA]
    description
    [Pubmed|21233158]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21233158], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by proline limitation ([SW|T-box]) [Pubmed|21233158]
  • expression requires functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • [protein|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|ProA] is absent from the membrane proteome of a '[protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|BdbC]-[protein|CED818CEF5B573A40F382157375E60C0B331F098|BdbD]' mutant [PubMed|22540663]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE13130 ([gene|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|proA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTTCACTCATTTTTCCGC, downstream forward: _UP4_TAGCGGGGTAATGTTCAATG
  • BKK13130 ([gene|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|proA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTTCACTCATTTTTCCGC, downstream forward: _UP4_TAGCGGGGTAATGTTCAATG
  • References

    Reviews

  • 25367752
  • Original publications

  • 19258532,21233158,22540663,21784929,17562291,23869754,25344233,28752945,30355672