SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


4-phosphopantetheinyl transferase (surfactin synthetase-activating enzyme), inactive pseudogene in strain 168
0.00 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
phosphopantetheinylates a serine residue in each of the seven peptidyl carrier protein domains of the first three subunits of surfactin synthetase (SrfAA-SrfAB-SrfAC) and AcpK
4-phosphopantetheinyl transferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    407,638 408,135

    Phenotypes of a mutant

  • No swarming motility on B medium. [Pubmed|19202088]
  • The protein

    Catalyzed reaction/ biological activity

  • CoA + apo-[peptidyl-carrier protein] = adenosine 3',5'-bisphosphate + holo-[peptidyl-carrier protein] (according to Swiss-Prot)
  • Protein family

  • P-Pant transferase superfamily (with [protein|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|AcpS], according to UniProt)
  • Biological materials


  • BKE03570 ([gene|1627167E7E9DBE444161A94D9F76317612C6401C|sfp/2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG, downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT
  • BKK03570 ([gene|1627167E7E9DBE444161A94D9F76317612C6401C|sfp/2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG, downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [ homepage]
  • References


  • 20735481
  • Original publications

  • 15955059,19202088,2848009,11489886,15065855,10581256,15066026,11867633,19202088,19749039,20094656,9484229,20148996,21278284,21466506