SubtiBank SubtiBank
sfp/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sfp/2

4-phosphopantetheinyl transferase (surfactin synthetase-activating enzyme), inactive pseudogene in strain 168
locus
BSU03570
pI
0.00
mw
0.00 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
phosphopantetheinylates a serine residue in each of the seven peptidyl carrier protein domains of the first three subunits of surfactin synthetase (SrfAA-SrfAB-SrfAC) and AcpK
product
4-phosphopantetheinyl transferase
essential
no
synonyms
sfp

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    407,638 408,135

    Phenotypes of a mutant

  • No swarming motility on B medium. [Pubmed|19202088]
  • The protein

    Catalyzed reaction/ biological activity

  • CoA + apo-[peptidyl-carrier protein] = adenosine 3',5'-bisphosphate + holo-[peptidyl-carrier protein] (according to Swiss-Prot)
  • Protein family

  • Gsp/sfp/hetI/acpT family (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE03570 ([gene|1627167E7E9DBE444161A94D9F76317612C6401C|sfp/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG, downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT
  • BKK03570 ([gene|1627167E7E9DBE444161A94D9F76317612C6401C|sfp/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG, downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • References

    Reviews

  • 20735481
  • Original publications

  • 15955059,19202088,2848009,11489886,15065855,10581256,15066026,11867633,19202088,19749039,20094656,9484229,20148996,21278284,21466506