SubtiBank SubtiBank
mleA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mleA

malic enzyme
locus
BSU_23550
pI
4.89
mw
45.73 kDa
protein length
439 aa Sequence Blast
gene length
1320 bp Sequence Blast
function
malate utilization
product
NAD-dependent malate dehydrogenase
essential
no
ec
1.1.1.38
synonyms
yqkJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • Gene

    Coordinates
    2,451,463 2,452,782

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ --> CO2 + NADH + pyruvate (according to UniProt)
  • H+ + oxaloacetate --> CO2 + pyruvate (according to UniProt)
  • Protein family

  • [SW|malic enzymes family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|YtsJ], [protein|BBBCD5F56779895189E21076AF165B901F654534|MalS]
  • [SW|Domains]

  • [SW|ACT domain] (aa 9-84) (according to UniProt)
  • Structure

  • [PDB|2A9F] (from Streptococcus pneumoniae, 42% identity from aa 90 - 435)
  • Expression and Regulation

    Operons

    genes
    [gene|49DF23B8E19658DB32835B6D23DD21E4BF481B20|mleN]-[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1711029], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|146947C974D62BCB282BA3F5B924B35695D75886|AnsR]: repression, [Pubmed|11914346], in [regulon|146947C974D62BCB282BA3F5B924B35695D75886|AnsR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    genes
    [gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]-[gene|49DF23B8E19658DB32835B6D23DD21E4BF481B20|mleN]-[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]
    description
    [Pubmed|22383849]

    regulation

  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C412 (yqkJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2410 NBRP B. subtilis, Japan]
  • GP1136 (cat) available in [SW|Jörg Stülke]'s lab
  • BKE23550 ([gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATTCAGTGATCCTCCC, downstream forward: _UP4_TAAATGTAGCTAAACAGCAC
  • BKK23550 ([gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATTCAGTGATCCTCCC, downstream forward: _UP4_TAAATGTAGCTAAACAGCAC
  • References

  • 16788182,11914346,22383849,23136871