SubtiBank SubtiBank
ktrC [2019-02-14 12:09:31]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ktrC [2019-02-14 12:09:31]

low affinity potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD], peripheric membrane component
24.20 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
potassium uptake
low affinity potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD], peripheric membrane component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Potassium uptake/ export]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,520,531 1,521,196

    The protein

    Paralogous protein(s)

  • [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]
  • [SW|Domains]

  • contains a [SW|RCK_N domain] at the N-terminus (according to [ UniProt])
  • contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (according to [ UniProt]) [Pubmed|23671116]
  • Effectors of protein activity

  • binds ADP and ATP [pubmed|30753894]
  • the protein binds c-di-AMP, KD = 30 nM [Pubmed|30753894]
  • Structure

  • [PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] complex, 56% identity) [Pubmed|23598340]
  • [PDB|4XTT] (the ''S. aureus'' KtrA [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]
  • [SW|Localization]

  • peripheral membrane protein [Pubmed|12562800]
  • Expression and Regulation




  • constitutively expressed [Pubmed|12562800]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002614], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|8002615], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • constitutively expressed [Pubmed|12562800]
  • view in new tab

    Biological materials


  • MGNA-A904 (ykqB::erm), available at the [ NBRP B. subtilis, Japan]
  • GHB6 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jrg Stlke]'s) labs, available at [ BGSC] as 1A955
  • GP2264 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''aphA3''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]
  • GP2048 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''cat''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]
  • GP2079 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]
  • GP2083 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]
  • BKE14510 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
  • BKK14510 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
  • Expression vectors

  • pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jrg Stlke]'s lab
  • References


  • 25869574,27935846,25838295
  • Original publications

  • 12562800,23671116,23598340,28420751,28504641
  • Labs working on this gene/protein

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]