SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


asparagine synthase (glutamine-hydrolysing)
70.54 kDa
protein length
614 aa Sequence Blast
gene length
1845 bp Sequence Blast
biosynthesis of asparagine
asparagine synthase (glutamine-hydrolysing)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aspartate/ asparagine]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,157,237 1,159,081

    Phenotypes of a mutant

  • inactivation of ''[gene|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO]'' renders cells asporogenous [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP L-aspartate L-glutamine H2O = AMP diphosphate L-asparagine L-glutamate (according to Swiss-Prot)
  • Protein family

  • glutamine amidotransferase type-2 domain (according to Swiss-Prot)
  • Structure

  • [PDB|1CT9] (from E. coli, 27% identity) [pubmed|10587437]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|10498721], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|10498721]
  • view in new tab

    Biological materials


  • BKE10790 ([gene|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACATCAGCTCCAAT, downstream forward: _UP4_TAGGTTCAATACAAATGTGA
  • BKK10790 ([gene|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACATCAGCTCCAAT, downstream forward: _UP4_TAGGTTCAATACAAATGTGA
  • References


  • 12859215,11395405
  • Original publications

  • 10498721,15383836,26735940,10587437