SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


resistence against antimicrobial compounds from B. amyloliquefaciens
56.66 kDa
protein length
493 aa Sequence Blast
gene length
1482 bp Sequence Blast
confers resistence against antimicrobial compounds from B. amyloliquefaciens

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    513,283 514,764

    The protein

    Protein family

  • UPF0699 family (with [protein|E4139214AB491712309F84A0792BCD8939F634D7|YdbS], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • view in new tab

    Biological materials


  • MGNA-C078 (ydbT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04600 ([gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGACATCATCGTCAGT, downstream forward: _UP4_TAATACCGCCGCTCCAGCGT
  • BKK04600 ([gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGACATCATCGTCAGT, downstream forward: _UP4_TAATACCGCCGCTCCAGCGT
  • References

  • 16629676,12207695,11866510