SubtiBank SubtiBank
ydbT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydbT

resistence against antimicrobial compounds from B. amyloliquefaciens
locus
BSU_04600
pI
9.50
mw
56.66 kDa
protein length
493 aa Sequence Blast
gene length
1482 bp Sequence Blast
function
confers resistence against antimicrobial compounds from B. amyloliquefaciens
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    513,283 514,764

    The protein

    Protein family

  • UPF0699 family (with [protein|E4139214AB491712309F84A0792BCD8939F634D7|YdbS], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]-[gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C078 (ydbT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2076 NBRP B. subtilis, Japan]
  • BKE04600 ([gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGACATCATCGTCAGT, downstream forward: _UP4_TAATACCGCCGCTCCAGCGT
  • BKK04600 ([gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGACATCATCGTCAGT, downstream forward: _UP4_TAATACCGCCGCTCCAGCGT
  • References

  • 16629676,12207695,11866510