SubtiBank SubtiBank
nasF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nasF

uroporphyrinogen methyltransferase
locus
BSU_03280
pI
6.52
mw
53.70 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
function
nitrate respiration
product
uroporphyrinogen methyltransferase
essential
no
ec
2.1.1.107
synonyms
nasBE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.2|Anaerobic respiration]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.1|Utilization of nitrate/ nitrite]
  • Gene

    Coordinates
    353,900 355,351

    The protein

    Catalyzed reaction/ biological activity

  • 2 S-adenosyl-L-methionine + uroporphyrinogen III --> H+ + precorrin-2 + 2 S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • precorrin methyltransferase family (with [protein|92831D5A8E07A18BA6C6978123769D00D685BB45|YlnD], according to UniProt)
  • Paralogous protein(s)

  • [protein|92831D5A8E07A18BA6C6978123769D00D685BB45|YlnD]:
  • Structure

  • [PDB|1PJQ] (CysG from ''Salmonella enterica'', 46% identity to N-terminal domain) [Pubmed|14595395]
  • Expression and Regulation

    Operons

    genes
    [gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
    description
    [Pubmed|7836289]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    genes
    [gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
    description
    [Pubmed|9765565]

    regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • BKE03280 ([gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCTTCCGTCACT, downstream forward: _UP4_TGATGGCAAGCAGCCCTTTT
  • BKK03280 ([gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCTTCCGTCACT, downstream forward: _UP4_TGATGGCAAGCAGCCCTTTT
  • References

    Reviews

  • 22103536
  • Original publications

  • 10217486,12823818,24214949,8799114,9765565,10972836,16885456,7868621,21091510,25755103,14595395