SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


uroporphyrinogen methyltransferase
53.70 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
nitrate respiration
uroporphyrinogen methyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Anaerobic respiration]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of nitrate/ nitrite]
  • Gene

    353,900 355,351

    The protein

    Catalyzed reaction/ biological activity

  • 2 S-adenosyl-L-methionine + uroporphyrinogen III --> H+ + precorrin-2 + 2 S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • precorrin methyltransferase family (with [protein|92831D5A8E07A18BA6C6978123769D00D685BB45|YlnD], according to UniProt)
  • Paralogous protein(s)

  • [protein|92831D5A8E07A18BA6C6978123769D00D685BB45|YlnD]:
  • Structure

  • [PDB|1PJQ] (CysG from ''Salmonella enterica'', 46% identity to N-terminal domain) [Pubmed|14595395]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab



  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • BKE03280 ([gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCTTCCGTCACT, downstream forward: _UP4_TGATGGCAAGCAGCCCTTTT
  • BKK03280 ([gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCTTCCGTCACT, downstream forward: _UP4_TGATGGCAAGCAGCCCTTTT
  • References


  • 22103536
  • Original publications

  • 10217486,12823818,24214949,8799114,9765565,10972836,16885456,7868621,21091510,25755103,14595395