SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


protease, degrades [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR] at a specific site
19.26 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
control of [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR] activity
site-specific protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    530,624 531,133

    Expression and Regulation


    view in new tab

    Biological materials


  • BKE04810 ([gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCTTTGCTTGTATAAATTG, downstream forward: _UP4_GCTTTTGGTTAAAGGAGAAA
  • BKK04810 ([gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCTTTGCTTGTATAAATTG, downstream forward: _UP4_GCTTTTGGTTAAAGGAGAAA
  • References

  • 21036995,18761623