kinE [2019-09-02 12:15:55]

two-component sensor kinase, phosphorylates Spo0F, part of the phosphorelay

Locus: BSU_13530

Isoelectric point: 5.49

Molecular weight: 85.32 kDa

Protein length: 738 aa

Gene length: 2217 bp

Function: initiation of sporulation

Product: two-component sensor kinase

Essential: no

Synonyms: ykrQ

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Two-component sensor kinase
• Information processing → Regulation of gene expression → phosphorelay → The kinases
• Lifestyles → Sporulation → phosphorelay → The kinases

Gene

Coordinates: 1,419,213 1,421,429

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of Spo0F
• ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

Paralogous protein(s)

• CssS, YclK, YvrG, YkoH

Domains

• two transmembrane segments
• PAS domain
• C-terminal histidine phosphotransferase domain

Modification

• autophosphorylation on a His residue

Expression and Regulation

Operons

• Genes: kinE-ogt
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

Biological materials

Mutant

• MGNA-B319 (ykrQ::erm), available at the NBRP B. subtilis, Japan
• BKE13530 (kinE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCATGTACACTCCTTCT, downstream forward: _UP4_GAATGAACTACTATACGACA
• BKK13530 (kinE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCATGTACACTCCTTCT, downstream forward: _UP4_GAATGAACTACTATACGACA

References

Loading