SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


oxalate decarboxylase, inner spore coat protein
43.39 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
protection of the spore
oxalate decarboxylase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class V]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    2,037,601 2,038,779

    The protein

    Catalyzed reaction/ biological activity

  • H+ + oxalate --> CO2 + formate (according to UniProt)
  • Paralogous protein(s)

  • [protein|9793E952C985BA268AC28C907900A03F4E8A3253|OxdC]
  • Structure

  • [PDB|1L3J] ([protein|9793E952C985BA268AC28C907900A03F4E8A3253|OxdC], 59% identity) [pubmed|14871895]
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,14973022], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|14973022], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|14973022]
  • view in new tab

    Biological materials


  • MGNA-A842 (yoaN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18670 ([gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCGTTTTAGAAA, downstream forward: _UP4_TAAAGACGTAACAGATCACA
  • BKK18670 ([gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCGTTTTAGAAA, downstream forward: _UP4_TAAAGACGTAACAGATCACA
  • References


  • 20464388,23202530
  • Original publications

  • 11546787,15699190,14973022,20601499,22171814,14871895,28870294