SubtiBank SubtiBank
oxdD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

oxdD

oxalate decarboxylase, inner spore coat protein
locus
BSU_18670
pI
5.36
mw
43.39 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
function
protection of the spore
product
oxalate decarboxylase
essential
no
ec
4.1.1.2
synonyms
yoaN

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    2,037,601 2,038,779

    The protein

    Catalyzed reaction/ biological activity

  • H+ + oxalate --> CO2 + formate (according to UniProt)
  • Paralogous protein(s)

  • [protein|9793E952C985BA268AC28C907900A03F4E8A3253|OxdC]
  • Structure

  • [PDB|1L3J] ([protein|9793E952C985BA268AC28C907900A03F4E8A3253|OxdC], 59% identity) [pubmed|14871895]
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]
    description
    [Pubmed|14973022]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,14973022], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|14973022], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|14973022]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A842 (yoaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/842 NBRP B. subtilis, Japan]
  • BKE18670 ([gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCGTTTTAGAAA, downstream forward: _UP4_TAAAGACGTAACAGATCACA
  • BKK18670 ([gene|1568DD457FDD482B3C14954A95F62BE338CBD15D|oxdD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCGTTTTAGAAA, downstream forward: _UP4_TAAAGACGTAACAGATCACA
  • References

    Reviews

  • 20464388,23202530
  • Original publications

  • 11546787,15699190,14973022,20601499,22171814,14871895,28870294