SubtiBank SubtiBank
trpA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

trpA

tryptophan synthase (alpha subunit)
locus
BSU22630
pI
4.82
mw
29.30 kDa
protein length
267 aa Sequence Blast
gene length
804 bp Sequence Blast
function
biosynthesis of tryptophan
product
tryptophan synthase (alpha subunit)
essential
no
ec
4.2.1.20
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,371,508 2,372,311

    The protein

    Catalyzed reaction/ biological activity

  • L-serine 1-C-(indol-3-yl)glycerol 3-phosphate = L-tryptophan glyceraldehyde 3-phosphate H2O (according to Swiss-Prot)
  • Protein family

  • TrpA family (according to Swiss-Prot)
  • Structure

  • [PDB|1WQ5] (from ''Escherichia coli'', 35% identity, 53% similarity) [Pubmed|15667212]
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22630 ([gene|155FE26C148F7022948DD7539533AB6876571862|trpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTGATGGTTGAAGAT, downstream forward: _UP4_TACAGTTTAAAATGAGGTGA
  • BKK22630 ([gene|155FE26C148F7022948DD7539533AB6876571862|trpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTGATGGTTGAAGAT, downstream forward: _UP4_TACAGTTTAAAATGAGGTGA
  • References

    Reviews

  • 18486479,11893063,11163353,7900177,19387555,12859215,11395405,12966138
  • Original publications

  • 14976255,3924737,6436812,2422155,8419914,1551827,21815947