SubtiBank SubtiBank
radA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

radA

branch migration transferase, 6-O-methylguanine-DNA methyltransferase, negative effector of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|DisA] activity, participates in the stabilization and/or processing of holliday junction intermediates, required for repair-by-recombination
locus
BSU_00870
pI
8.13
mw
49.32 kDa
protein length
458 aa Sequence Blast
gene length
1377 bp Sequence Blast
function
homologous recombination, control of c-di-AMP formation, co-ordination of responses to replicative stress and genetic recombination
product
branch migration transferase, 6-O-methylguanine-DNA methyltransferase
essential
no
synonyms
sms,yacJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    106,096 107,472

    Phenotypes of a mutant

  • reduced spore survival after infrared exposure [pubmed|28961460]
  • sensitive to mitomycin C and H2O2-induced DNA damage [pubmed|30877841]
  • impaired in transformation with chromosomal DNA [pubmed|30877841]
  • no transformation with chromosomal DNA in [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] mutant cells [pubmed|31350886]
  • The protein

    Catalyzed reaction/ biological activity

  • reduces the activity of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|DisA] [pubmed|23760274]
  • binds ssDNA and Holliday junctions (preferentially over dsDNA) [pubmed|30877841]
  • promotes [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated DNA strand exchange [pubmed|30877841]
  • ATPase and 5' --> 3' DNA helicase activity [pubmed|30877841]
  • unwinds forked DNA in the 5′→3′ direction [pubmed|31350886]
  • Protein family

  • RecA family (together with [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]) (according to UniProt)
  • [SW|Domains]

  • N-terminal zinc finger (aa 10 ... 27) (according to UniProt)
  • central RecA-like ATPase domain (according to UniProt)
  • KNRFG motif (aa 255 ... 259) (according to UniProt)
  • C-terminal Lon domain (aa 354 ... 458) (according to UniProt)
  • Structure

  • [PDB|5LKM] (from Streptococcus pneumoniae, 63% identity) [pubmed|28561029]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
    description
    [Pubmed|8793870]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30962353], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • induction during diamide stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30962353]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B931 (yacJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1930 NBRP B. subtilis, Japan]
  • BKG1 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKG2 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::spc''), available in [SW|Jörg Stülke]'s lab
  • BKE00870 ([gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAGTGTAAGACCTC, downstream forward: _UP4_CGTACTTCATTAGGAGGATA
  • BKK00870 ([gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAGTGTAAGACCTC, downstream forward: _UP4_CGTACTTCATTAGGAGGATA
  • Expression vectors

  • pGP2693: expression in ''E. coli'', with C-terminal Strep-tag, in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 26459995
  • Original publications

  • 8793870,9987115,15317759,23760274,11544224,25484163,11810266,28511132,28961460,28561029,26845522,30877841,31350886