SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


branch migration transferase, 6-O-methylguanine-DNA methyltransferase, negative effector of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|DisA] activity, participates in the stabilization and/or processing of holliday junction intermediates, required for repair-by-recombination
49.32 kDa
protein length
458 aa Sequence Blast
gene length
1377 bp Sequence Blast
homologous recombination, control of c-di-AMP formation, co-ordination of responses to replicative stress and genetic recombination
branch migration transferase, 6-O-methylguanine-DNA methyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    106,096 107,472

    Phenotypes of a mutant

  • reduced spore survival after infrared exposure [pubmed|28961460]
  • sensitive to mitomycin C and H2O2-induced DNA damage [pubmed|30877841]
  • impaired in transformation with chromosomal DNA [pubmed|30877841]
  • no transformation with chromosomal DNA in [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] mutant cells [pubmed|31350886]
  • The protein

    Catalyzed reaction/ biological activity

  • reduces the activity of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|DisA] [pubmed|23760274]
  • binds ssDNA and Holliday junctions (preferentially over dsDNA) [pubmed|30877841]
  • promotes [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated DNA strand exchange [pubmed|30877841]
  • ATPase and 5' --> 3' DNA helicase activity [pubmed|30877841]
  • unwinds forked DNA in the 5′→3′ direction [pubmed|31350886]
  • Protein family

  • RecA family (together with [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]) (according to UniProt)
  • [SW|Domains]

  • N-terminal zinc finger (aa 10 ... 27) (according to UniProt)
  • central RecA-like ATPase domain (according to UniProt)
  • KNRFG motif (aa 255 ... 259) (according to UniProt)
  • C-terminal Lon domain (aa 354 ... 458) (according to UniProt)
  • Structure

  • [PDB|5LKM] (from Streptococcus pneumoniae, 63% identity) [pubmed|28561029]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30962353], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • induction during diamide stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30962353]
  • view in new tab

    Biological materials


  • MGNA-B931 (yacJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKG1 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKG2 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::spc''), available in [SW|Jörg Stülke]'s lab
  • BKE00870 ([gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAGTGTAAGACCTC, downstream forward: _UP4_CGTACTTCATTAGGAGGATA
  • BKK00870 ([gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAGTGTAAGACCTC, downstream forward: _UP4_CGTACTTCATTAGGAGGATA
  • Expression vectors

  • pGP2693: expression in ''E. coli'', with C-terminal Strep-tag, in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • References


  • 26459995
  • Original publications

  • 8793870,9987115,15317759,23760274,11544224,25484163,11810266,28511132,28961460,28561029,26845522,30877841,31350886