SubtiBank SubtiBank
ybeC [2018-02-13T14:26:15.000Z]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

ybeC [2018-02-13T14:26:15.000Z]

similar to amino acid transporter
locus
BSU02120
pI
9.82
mw
59.03 kDa
protein length
539 aa Sequence Blast
gene length
1617 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    231,348 → 232,967

    The protein

    Paralogous protein(s)

  • [protein|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|YveA]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B963 (ybeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1962 NBRP B. subtilis, Japan]
  • BKE02120 (Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • BKK02120 (Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • References

  • 18763711