SubtiBank SubtiBank
ybeC [2019-03-25 13:21:24]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ybeC [2019-03-25 13:21:24]

similar to amino acid transporter
locus
BSU02120
pI
9.82
mw
59.03 kDa
protein length
539 aa Sequence Blast
gene length
1620 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    231,348 232,967

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|YveA]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1886 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::cat, available in [SW|Jörg Stülke]'s lab
  • GP2786 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::aphA3, available in [SW|Jörg Stülke]'s lab
  • MGNA-B963 (ybeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1962 NBRP B. subtilis, Japan]
  • BKE02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • BKK02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • lacZ fusion

  • pGP2287 (in [SW|pAC5]) (GP2965), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711