SubtiBank SubtiBank
ybeC [2019-03-25 13:23:51]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ybeC [2019-03-25 13:23:51]

similar to amino acid transporter
59.03 kDa
protein length
539 aa Sequence Blast
gene length
1620 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of alanine/ serine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    231,348 232,967

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|YveA]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP1886 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::cat, available in [SW|Jörg Stülke]'s lab
  • GP2786 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::aphA3, available in [SW|Jörg Stülke]'s lab
  • MGNA-B963 (ybeC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • BKK02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • GP2831 (''Δ''''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''aphA3'' ''Δ''''[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2287 (in [SW|pAC5]) (GP2965), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711