SubtiBank SubtiBank
ybeC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybeC

similar to amino acid transporter
locus
BSU_02120
pI
9.82
mw
59.03 kDa
protein length
539 aa Sequence Blast
gene length
1620 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    231,348 232,967

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|YveA]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1886 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::cat, available in [SW|Jörg Stülke]'s lab
  • GP2786 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::aphA3, available in [SW|Jörg Stülke]'s lab
  • MGNA-B963 (ybeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1962 NBRP B. subtilis, Japan]
  • BKE02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • BKK02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • GP2831 (''Δ''''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''aphA3'' ''Δ''''[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2287 (in [SW|pAC5]) (GP2965), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP3062 ''ybeC-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711