SubtiBank SubtiBank
rok
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rok

repressor of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK], nucleoid associated protein that serves to help repress expression of A T-rich genes, many of which appear to have been acquired by horizontal gene transfer
locus
BSU_14240
pI
9.70
mw
21.69 kDa
protein length
191 aa Sequence Blast
gene length
576 bp Sequence Blast
function
regulation of genetic competence
product
transcriptional repressor
essential
no
synonyms
ykuW

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    1,493,787 1,494,362

    Phenotypes of a mutant

  • higher excision rate of the conjugative transposon ICEBs1 [Pubmed|21085634]
  • The protein

    Catalyzed reaction/ biological activity

  • binds to extended regions of the ''B. subtilis'' genome that are characterized by a high A+T content and are known or believed to have been acquired by horizontal gene transfer [Pubmed|21085634]
  • Effectors of protein activity

  • activity is modulated by interaction with [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860]
  • Structure

  • [PDB|5ZUX] (complexed with DNA) [Pubmed|30252102]
  • [PDB|5ZUZ] [Pubmed|30252102]
  • Expression and Regulation

    Operons

    genes
    [gene|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]
    description
    [Pubmed|12354229]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|11849533], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|11849533], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|11849533], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|search|Rok] [Pubmed|11849533]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B345 (ykuW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1344 NBRP B. subtilis, Japan]
  • BKE14240 ([gene|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCAATGTACCCCCT, downstream forward: _UP4_TAAATATAAAGAAAAACTGC
  • BKK14240 ([gene|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCAATGTACCCCCT, downstream forward: _UP4_TAAATATAAAGAAAAACTGC
  • References

    Reviews

  • 19995980
  • Original publications

  • 21085634,12354229,14651647,11849533,21097620,15743949,27375604,27902860,30252102,30808982