SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


2-isopropylmalate synthase
56.74 kDa
protein length
518 aa Sequence Blast
gene length
1557 bp Sequence Blast
biosynthesis of leucine
2-isopropylmalate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,892,138 2,893,694

    The protein

    Catalyzed reaction/ biological activity

  • Acetyl-CoA + 3-methyl-2-oxobutanoate + H2O = (2S)-2-isopropylmalate + CoA (according to Swiss-Prot)
  • Protein family

  • LeuA type 1 subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|3EEG] (from ''Cytophaga hutchinsonii atcc 33406'', 53% identity, 68% similarity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • membrane [Pubmed|18763711]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1577690], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: termination/antitermination, via tRNA controlled [SW|RNA switch], repression by BCAA, in [regulon|T-box|T-box]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|15547269], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|12193635], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [PubMed|12193635]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE28280 ([gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCACGAAGCGTCGTATCGA, downstream forward: _UP4_TAAAAGAAAGGAGAACGGTT
  • BKK28280 ([gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCACGAAGCGTCGTATCGA, downstream forward: _UP4_TAAAAGAAAGGAGAACGGTT
  • References

  • 15060025,12193635,19258532,8289305,18641142,20525796,15547269,12618455,12107147,18763711,25157083,20935095,24163341,15378759,25755103,26220295