SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative C-S lyase, required for [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
45.91 kDa
protein length
421 aa Sequence Blast
gene length
1266 bp Sequence Blast
modification of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp]
putative C-S lyase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,876,584 1,877,849

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein


  • PLP (according to UniProt)
  • Structure

  • [PDB|3JZL] (from ''Listeria monocytogenes str. 4b f2365'', 67% identity, 80% similarity) [Pubmed|15770647], [protein|search|3HT4] (from Bacillus Cereus, 99% indentity)
  • Expression and Regulation




  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B092 (ynbB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17440 ([gene|14EFA3BF4E5DD5368EF02B0733300CEF7A4E0DC7|ynbB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACATGTCTTTATATTTCC, downstream forward: _UP4_TAAATTTTTTAAAAATTTCT
  • BKK17440 ([gene|14EFA3BF4E5DD5368EF02B0733300CEF7A4E0DC7|ynbB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACATGTCTTTATATTTCC, downstream forward: _UP4_TAAATTTTTTAAAAATTTCT
  • References

    Research papers

  • 29615499