SubtiBank SubtiBank
spoIIM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIIM

required for dissolution of the septal cell wall
locus
BSU_23530
pI
9.84
mw
24.15 kDa
protein length
214 aa Sequence Blast
gene length
645 bp Sequence Blast
function
dissolution of the septal cell wall
product
sporulation protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,450,403 2,451,047

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • the complex of [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID], [protein|14852D54F8B7344AA80D535F8EBBCE11E2B859CF|SpoIIM], and [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP] localizes at the leading edge of the mother cell engulfing membrane and is essential and rate limiting for membrane migration [Pubmed|20382772,12502745]
  • Expression and Regulation

    Operons

    genes
    [gene|14852D54F8B7344AA80D535F8EBBCE11E2B859CF|spoIIM]
    description
    [Pubmed|8501065]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8501065], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8501065]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C416 (spoIIM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2414 NBRP B. subtilis, Japan]
  • BKE23530 ([gene|14852D54F8B7344AA80D535F8EBBCE11E2B859CF|spoIIM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGTTTCCTCCCGCCC, downstream forward: _UP4_TAAAATCATTATTAAAAGAA
  • BKK23530 ([gene|14852D54F8B7344AA80D535F8EBBCE11E2B859CF|spoIIM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGTTTCCTCCCGCCC, downstream forward: _UP4_TAAAATCATTATTAAAAGAA
  • References

  • 17376078,11886548,15752199,8501065,15383836,23859254,20382772,12502745,31282858