SubtiBank SubtiBank
yteS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yteS

unknown
locus
BSU_30110
pI
4.77
mw
17.62 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,080,631 3,081,134

    Expression and Regulation

    Operons

    genes
    [gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]-[gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]-[gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]-[gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]-[gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]-[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • MGNA-A812 (yteS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/812 NBRP B. subtilis, Japan]
  • BKE30110 ([gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCCGTACGTATCCTTT, downstream forward: _UP4_GAAGCCCGATAGAGGTGAGG
  • BKK30110 ([gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCCGTACGTATCCTTT, downstream forward: _UP4_GAAGCCCGATAGAGGTGAGG
  • References

  • 12884008,17449691,27766092