SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


D-chiro-inositol transport protein
47.03 kDa
protein length
439 aa Sequence Blast
gene length
1317 bp Sequence Blast
D-chiro-inositol uptake
D-chiro-inositol transport protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,076,842 → 4,078,158

    The protein

    Catalyzed reaction/ biological activity

  • uptake of D-chiro-inositol [Pubmed|20530884]
  • Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Structure

  • [PDB|4LDS] (from S. epidermidis, 26% identity) [pubmed|24127585]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials


  • MGNA-B697 (iolF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39710 (Δ[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCCCATTA, downstream forward: _UP4_TAACCAACAGAAGGAGTGGC
  • BKK39710 (Δ[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCCCATTA, downstream forward: _UP4_TAACCAACAGAAGGAGTGGC
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,11807058,9887260,18310071,20530884,24127585