SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


recombination protein, modulates the SOS response and facilitates [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated recombinational repair and genetic recombination
30.86 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
[SW|DNA repair/ recombination]
recombination protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    925,633 926,427

    Phenotypes of a mutant

  • reduced natural transformation with plasmid or chromosomal DNA [Pubmed|23284295]
  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • The protein

    Catalyzed reaction/ biological activity

  • modulates the "length or packing" of a [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] filament, thereby [protein|144E7D10740C5F146403612B8A0C88E02FB9C572|RecX] facilitates the initiation of recombination and increases recombination across species [Pubmed|23284295]
  • inhibits [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-catalyzed ATP hydrolysis [pubmed|28911099]
  • inhibits stable [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleation and polymerization on ssDNA [pubmed|28911099]
  • induces [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleoprotein filament depolymerization [pubmed|28911099]
  • promotes a net [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly from viral ssDNAs not homologous to the host genome [pubmed|31876108]
  • Protein family

  • recX family (single member, according to UniProt)
  • Structure

  • [PDB|3D5L] (from Lactobacillus reuterii, 36% identity)
  • [SW|Localization]

  • forms foci on the nucleoid upon DNA damage [Pubmed|23284295]
  • forms foci at the cells poles and/ or the nucleoid upon induction of genetic competence [Pubmed|23284295]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C361 (yfhG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08520 ([gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA
  • BKK08520 ([gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA
  • References

  • 23284295,22383849,24285298,24285298,28911099,30050509,31876108