SubtiBank SubtiBank
yqfZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqfZ

unknown
locus
BSU_25060
pI
8.09
mw
10.63 kDa
protein length
gene length
300 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,588,701 2,589,000

    The protein

    [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] [Pubmed|18430080]
  • [SW|LysM domain] (aa 48-95) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885|yqfZ]-[gene|4992F5C2ED7DE37C08D5715F7E8851F5FDB51059|ispG]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|12662922,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C488 (yqfZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2486 NBRP B. subtilis, Japan]
  • BKE25060 ([gene|144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885|yqfZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTTTCCTCCCGCAT, downstream forward: _UP4_TAATTTAACGTTAATTTCTT
  • BKK25060 ([gene|144A8B3F5E534F3FD6EFC1E9A5ED650E09DCE885|yqfZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTTTCCTCCCGCAT, downstream forward: _UP4_TAATTTAACGTTAATTTCTT
  • References

    Reviews

  • 18430080
  • Original publications

  • 12662922,15383836