SubtiBank SubtiBank
yvlB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvlB

unknown
locus
BSU_35120
pI
5.39
mw
40.92 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,607,325 3,608,422

    Expression and Regulation

    Operons

    genes
    [gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]-[gene|1443F7E8B8DDA6BDDEFF07E21E64F9D574E0FB1B|yvlB]-[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]-[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by cell wall stress ([protein|search|SigW]) [Pubmed|9987136,12207695]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A381 (yvlB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/381 NBRP B. subtilis, Japan]
  • BKE35120 ([gene|1443F7E8B8DDA6BDDEFF07E21E64F9D574E0FB1B|yvlB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGATCTCCTCCCCAT, downstream forward: _UP4_CTAAAGTACTCACAGAGGTG
  • BKK35120 ([gene|1443F7E8B8DDA6BDDEFF07E21E64F9D574E0FB1B|yvlB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGATCTCCTCCCCAT, downstream forward: _UP4_CTAAAGTACTCACAGAGGTG
  • References

  • 12076816,220817675,9987136,12207695