SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to monooxygenase
34.86 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    310,880 311,875

    The protein

    Protein family

  • Flavin-utilizing monoxygenases
  • Paralogous protein(s)

  • [protein|A1DCFF8D225C87197104742E72A0D4F238BC30EB|YwcH]
  • [protein|40654E556CC97A4E47FC757F93F29BEACD21CC3A|YddN]:
  • [protein|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|YvbT]:
  • [protein|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|CmoO]:
  • Structure

  • [PDB|4US5] (from Streptomyces bottropensis, 39% identity) [pubmed|24554499]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B983 (yceB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02880 ([gene|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|yceB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGCCGCTTCCTTTCT, downstream forward: _UP4_TAAAAAAAGCAGTTTTCCCT
  • BKK02880 ([gene|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|yceB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGGCCGCTTCCTTTCT, downstream forward: _UP4_TAAAAAAAGCAGTTTTCCCT
  • References

    Research papers

  • 24554499