SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


holin, required for spore morphogenesis and germination
9.82 kDa
protein length
gene length
264 bp Sequence Blast
required for spore morphogenesis and germination

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,914,009 3,914,272

    Phenotypes of a mutant

  • forms spores with a reduced outer coat [pubmed|16159778]
  • The protein

    Protein family

  • ywcE family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [pubmed|16159778]
  • spore core membran [pubmed|16159778]
  • spore outer membran [pubmed|16159778]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16159778], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|16159778], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • repressed during the log phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]), expressed only at the onset of stationary phase [Pubmed|16159778]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033]
  • view in new tab

    Biological materials


  • BKE38130 ([gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT
  • BKK38130 ([gene|1426D5E85EA17234A3E2C98018DA99437F8E712C|ywcE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT
  • labs

  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References

  • 16159778,9353933,23033921,28439033