SubtiBank SubtiBank
yfmB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmB

unknown
locus
BSU_07530
pI
5.48
mw
13.89 kDa
protein length
122 aa Sequence Blast
gene length
369 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    826,843 827,211

    The protein

    Structure

  • [PDB|2EUC]
  • Expression and Regulation

    Operons

    genes
    [gene|13FEC673232C5946C6EA7E9DD3AA6AA1A57269E1|yfmB]-[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620,12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|16672620,12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C247 (yfmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2245 NBRP B. subtilis, Japan]
  • BKE07530 ([gene|13FEC673232C5946C6EA7E9DD3AA6AA1A57269E1|yfmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGACATACCTCCTGCT, downstream forward: _UP4_TAAAAACGCAGCTTTCTTTA
  • BKK07530 ([gene|13FEC673232C5946C6EA7E9DD3AA6AA1A57269E1|yfmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGACATACCTCCTGCT, downstream forward: _UP4_TAAAAACGCAGCTTTCTTTA
  • References

  • 22383849,23199363