SubtiBank SubtiBank
flhP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

flhP

flagellar hook-basal body rod protein, required for hook assembly
locus
BSU_36390
pI
4.59
mw
29.25 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
function
motility and chemotaxis
product
flagellar hook-basal body rod protein
essential
no
synonyms
yvyB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,745,436 3,746,245

    Phenotypes of a mutant

  • lack of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression (no ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' expression), no motility [Pubmed|22730131]
  • defective in swarming and flagellar assembly [pubmed|30201778]
  • The protein

    Catalyzed reaction/ biological activity

  • assembly of the flagellar hook [Pubmed|22730131]
  • Protein family

  • [SW|Flagella basal body rod proteins family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8EFE091CFB89FC406CD60776977C9C302C7826E0|FlhO], [protein|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|FlgE]
  • Structure

  • [PDB|5WRH] (from Salmonella typhimurium, 31% identity) [pubmed|28120828]
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • flagellum hook (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8EFE091CFB89FC406CD60776977C9C302C7826E0|flhO]-[gene|13F35BC7EE8215D7A92A639BEB18647AC276D215|flhP]
    description
    [Pubmed|15033535,22730131]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535,22730131], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE36390 ([gene|13F35BC7EE8215D7A92A639BEB18647AC276D215|flhP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTGATGTCCCCCGTT, downstream forward: _UP4_TAATAAGAAAATGGGCGTTT
  • BKK36390 ([gene|13F35BC7EE8215D7A92A639BEB18647AC276D215|flhP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTGATGTCCCCCGTT, downstream forward: _UP4_TAATAAGAAAATGGGCGTTT
  • References

    Reviews

  • 26490009
  • Original publications

  • 18957862,9023218,7836311,15033535,22383849,30201778,28120828