SubtiBank SubtiBank
flhP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

flhP

flagellar hook-basal body rod protein, required for hook assembly
locus
BSU36390
pI
4.59
mw
29.25 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
function
motility and chemotaxis
product
flagellar hook-basal body rod protein
essential
no
synonyms
yvyB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,745,436 3,746,245

    Phenotypes of a mutant

  • lack of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression (no ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' expression), no motility [Pubmed|22730131]
  • defective in swarming and flagellar assembly [pubmed|30201778]
  • The protein

    Catalyzed reaction/ biological activity

  • assembly of the flagellar hook [Pubmed|22730131]
  • Protein family

  • [SW|Flagella basal body rod proteins family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8EFE091CFB89FC406CD60776977C9C302C7826E0|FlhO], [protein|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|FlgE]
  • Structure

  • [PDB|5WRH] (from Salmonella typhimurium, 31% identity) [pubmed|28120828]
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • flagellum hook (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8EFE091CFB89FC406CD60776977C9C302C7826E0|flhO]-[gene|13F35BC7EE8215D7A92A639BEB18647AC276D215|flhP]
    description
    [Pubmed|15033535,22730131]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535,22730131], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE36390 ([gene|13F35BC7EE8215D7A92A639BEB18647AC276D215|flhP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTGATGTCCCCCGTT, downstream forward: _UP4_TAATAAGAAAATGGGCGTTT
  • BKK36390 ([gene|13F35BC7EE8215D7A92A639BEB18647AC276D215|flhP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTGATGTCCCCCGTT, downstream forward: _UP4_TAATAAGAAAATGGGCGTTT
  • References

    Reviews

  • 26490009
  • Original publications

  • 18957862,9023218,7836311,15033535,22383849,30201778,28120828