SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyrrolidone-carboxylate peptidase
23.63 kDa
protein length
215 aa Sequence Blast
gene length
648 bp Sequence Blast
removal of the N-terminal pyroglutamyl group from peptides
pyrrolidone-carboxylate peptidase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • Gene

    286,773 287,420

    The protein

    Catalyzed reaction/ biological activity

  • Release of an N-terminal pyroglutamyl group from a polypeptide, the second amino acid generally not being Pro (according to UniProt)
  • Protein family

  • peptidase C15 family (single member, according to UniProt)
  • Structure

  • [PDB|1AUG] (from B. amyloliquefaciens, 72% identity) [pubmed|10196127]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE02650 ([gene|13E80EAC33C30BB0BBF08A0F0E37EB18CC87C8CA|pcp]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCCATCTCCTTTTT, downstream forward: _UP4_CACTAAGCGGCCGCCGCTGT
  • BKK02650 ([gene|13E80EAC33C30BB0BBF08A0F0E37EB18CC87C8CA|pcp]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCCATCTCCTTTTT, downstream forward: _UP4_CACTAAGCGGCCGCCGCTGT
  • References

  • 1362573,1353026,10196127