SubtiBank SubtiBank
yodT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yodT

similar to adenosylmethionine-8-amino-7-oxononanoate aminotransferase
locus
BSU_19740
pI
5.96
mw
48.25 kDa
protein length
444 aa Sequence Blast
gene length
1332 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,144,356 → 2,145,690

    The protein

    Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|YhxA]:
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3I4J] (from Deinococcus Radiodurans 39% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]-[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]-[gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]-[gene|161ADC907D4902001C8751F51CFA762828C26110|yodQ]-[gene|39749B5EADC3C056BAF232E0B586C65B989F7F77|yodP]-[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]-[gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]-[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]
    description
    [Pubmed|22383849,14523133]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|14523133]
  • view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B508 (yodT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1507 NBRP B. subtilis, Japan]
  • BKE19740 (Δ[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCCCACCTCAAAACC, downstream forward: _UP4_AACTTAAAAAAGGATTGACA
  • BKK19740 (Δ[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCCCACCTCAAAACC, downstream forward: _UP4_AACTTAAAAAAGGATTGACA
  • References

  • 14523133