SubtiBank SubtiBank
yokI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yokI

putative toxin
locus
BSU_21580
pI
5.76
mw
64.12 kDa
protein length
571 aa Sequence Blast
gene length
1716 bp Sequence Blast
function
unknown
product
putative toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,275,706 2,277,421

    The protein

    [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]-[gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]-[gene|8BA8DB1483190AB847F28F3E56C247FE85C3225E|yokK]-[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE21580 ([gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCTTTCAAG, downstream forward: _UP4_AACTTTAGAAAGTAGGTGCG
  • BKK21580 ([gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCTCCTTTCAAG, downstream forward: _UP4_AACTTTAGAAAGTAGGTGCG
  • References

  • 22200572,20817675