SubtiBank SubtiBank
yizD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yizD

unknown
locus
BSU_11549
pI
9.70
mw
6.40 kDa
protein length
gene length
168 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,233,133 1,233,300

    Expression and Regulation

    Operons

    genes
    [gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE11549 ([gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11549 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGGTCCTCCTCGTCC, downstream forward: _UP4_TAAAAAAGCCTGTGCGTCAT
  • BKK11549 ([gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11549 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGGTCCTCCTCGTCC, downstream forward: _UP4_TAAAAAAGCCTGTGCGTCAT
  • References

  • 20525796