SubtiBank SubtiBank
yizD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yizD

[SW|sporulation] protein
locus
BSU_11549
pI
9.70
mw
6.40 kDa
protein length
gene length
168 bp Sequence Blast
function
unknown
product
[SW|sporulation] protein
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,233,133 1,233,300

    Phenotypes of a mutant

  • the mutant forms less heat-resistant spores than the wild type strain [pubmed|32061128]
  • The protein

    [SW|Localization]

  • outer membrane of the forespore [pubmed|32061128]
  • Expression and Regulation

    Operons

    genes
    [gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: , [pubmed|32061128], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE11549 ([gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11549 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGGTCCTCCTCGTCC, downstream forward: _UP4_TAAAAAAGCCTGTGCGTCAT
  • BKK11549 ([gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11549 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGGTCCTCCTCGTCC, downstream forward: _UP4_TAAAAAAGCCTGTGCGTCAT
  • References

  • 20525796,32061128