SubtiBank SubtiBank
yojW
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yojW

unknown
locus
BSU_19999
pI
5.55
mw
6.60 kDa
protein length
gene length
168 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,158,120 2,158,287

    Biological materials

    Mutant

  • BKE19999 ([gene|137E234994B01CFD6CCF3359EE721E2917E517C3|yojW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19999 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCATATTTCGCTT, downstream forward: _UP4_GACCAAAACTGGGTGGGGGA
  • BKK19999 ([gene|137E234994B01CFD6CCF3359EE721E2917E517C3|yojW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19999 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCATATTTCGCTT, downstream forward: _UP4_GACCAAAACTGGGTGGGGGA