SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to RNA-binding Sun protein, similar to S-adenosyl-L-methionine-dependent 16S rRNA m5C967 methyltransferase
50.11 kDa
protein length
447 aa Sequence Blast
gene length
1344 bp Sequence Blast
rRNA modification
S-adenosyl-L-methionine-dependent 16S rRNA m5C967 methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation/ based on similarity]
  • Gene

    1,647,939 1,649,282

    The protein

    Catalyzed reaction/ biological activity

  • cytidine967 in 16S rRNA + S-adenosyl-L-methionine --> 5-methylcytidine967 in 16S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|1SQF] (''E. coli'' Fmu protein, complex with SAM) [Pubmed|14656444]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16964327], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab



  • [pubmed|22383849]
  • view in new tab

    Biological materials


  • MGNA-B373 (yloM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15740 ([gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCTCAAGGGCGATGTCAC, downstream forward: _UP4_AGCATGAGAAAGAAGGGATA
  • BKK15740 ([gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCTCAAGGGCGATGTCAC, downstream forward: _UP4_AGCATGAGAAAGAAGGGATA
  • References

  • 16964327,14656444