SubtiBank SubtiBank
yloM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yloM

similar to RNA-binding Sun protein, similar to S-adenosyl-L-methionine-dependent 16S rRNA m5C967 methyltransferase
locus
BSU_15740
pI
6.95
mw
50.11 kDa
protein length
447 aa Sequence Blast
gene length
1344 bp Sequence Blast
function
rRNA modification
product
S-adenosyl-L-methionine-dependent 16S rRNA m5C967 methyltransferase
essential
no
synonyms
sun

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    1,647,939 1,649,282

    The protein

    Catalyzed reaction/ biological activity

  • cytidine967 in 16S rRNA + S-adenosyl-L-methionine --> 5-methylcytidine967 in 16S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|1SQF] (''E. coli'' Fmu protein, complex with SAM) [Pubmed|14656444]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]
    description
    [Pubmed|16964327]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16964327], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]-[gene|2B67C63442F28F6BCBA3BA6DE4B563C73E8DF16C|yloI]-[gene|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|priA]-[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]

    description

  • [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B373 (yloM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1372 NBRP B. subtilis, Japan]
  • BKE15740 ([gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCTCAAGGGCGATGTCAC, downstream forward: _UP4_AGCATGAGAAAGAAGGGATA
  • BKK15740 ([gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCTCAAGGGCGATGTCAC, downstream forward: _UP4_AGCATGAGAAAGAAGGGATA
  • References

  • 16964327,14656444