SubtiBank SubtiBank
yolC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yolC

unknown
locus
BSU_21520
pI
9.48
mw
12.65 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,272,156 2,272,491

    Expression and Regulation

    Operons

    genes
    [gene|1352BE96CAA6D527E98D715DF85587B653697998|yolC]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • in duced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • BKE21520 ([gene|1352BE96CAA6D527E98D715DF85587B653697998|yolC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAACCATTACACTCTCC, downstream forward: _UP4_TAAAATGCCCAGCTCTTTAT
  • BKK21520 ([gene|1352BE96CAA6D527E98D715DF85587B653697998|yolC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAACCATTACACTCTCC, downstream forward: _UP4_TAAAATGCCCAGCTCTTTAT
  • References

  • 16267290,20817675