SubtiBank SubtiBank
citT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

citT

two-component response regulator, regulation of citrate uptake
locus
BSU_07590
pI
6.36
mw
25.26 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
regulation of citrate uptake
product
two-component response regulator
essential
no
synonyms
yflQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    832,545 833,225

    Phenotypes of a mutant

  • no growth with citrate as sole carbon source [Pubmed|10972810]
  • The protein

    Catalyzed reaction/ biological activity

  • binding to the promoter of the ''[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]-[gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]'' operon and activation of transcription in the presence of citrate [Pubmed|10972810]
  • Modification

  • phosphorylated by [protein|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|CitS] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000044 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]-[gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]-[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]
    description
    [Pubmed|10972810]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C250 (citT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2248 NBRP B. subtilis, Japan]
  • BKE07590 ([gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATCCTCCGCAATCGCG, downstream forward: _UP4_TATTATTTGGCGGCGGATTA
  • BKK07590 ([gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATCCTCCGCAATCGCG, downstream forward: _UP4_TATTATTTGGCGGCGGATTA
  • References

    Reviews

  • 28152228
  • Original publications

  • 10094672,16842348,10972810