SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


molybdopterin synthase (large subunit), catalyses the transfer of sulfide from MoaD thiocarboxylate
17.64 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
nitrate respiration
molybdopterin synthase (large subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of molybdopterin]
  • Gene

    1,498,966 1,499,439

    The protein

    Catalyzed reaction/ biological activity

  • catalyses the transfer of sulfide from [protein|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|MoaD] thiocarboxylate
  • 2 [molybdopterin-synthase sulfur-carrier protein]-C-terminal Gly-NH-CH2-C(O)SH + cyclic pyranopterin phosphate + H2O --> 2 [molybdopterin-synthase sulfur-carrier protein]-C-terminal Gly-Gly + 4 H+ + molybdopterin (according to UniProt)
  • Protein family

  • moaE family (single member, according to UniProt)
  • Structure

  • [PDB|1NVI] (the [protein|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|MoaD]-[protein|12F27FA4DB8232B52271565C4F4937520A4F5C7B|MoaE] complex from ''E. coli'') [Pubmed|12571227]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE14300 ([gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTAATCTCAAACCGTT, downstream forward: _UP4_CCAGACCTAAGCGAGGGAGA
  • BKK14300 ([gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTAATCTCAAACCGTT, downstream forward: _UP4_CCAGACCTAAGCGAGGGAGA
  • References


  • 22616866,23539623
  • Original publications

  • 12571227,22383849