SubtiBank SubtiBank
bdbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bdbB

thiol-disulfide oxidoreductase
locus
BSU_21440
pI
9.41
mw
17.00 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
oxidative folding of proteins
product
thiol-disulfide oxidoreductase
essential
no
synonyms
yolK

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,265,225 2,265,671

    The protein

    Catalyzed reaction/ biological activity

  • oxidative folding of [protein|1A6D90298D039FFFD977B2534952BA5E32B3530F|SunA] (together with [protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|BdbC])
  • Protein family

  • DsbB family (with [protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|BdbC], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|260693EE7F5B5CE2A141149D292405E84B7A5FF4|sunT]-[gene|DB5F719C0A2F610301E174F6890DA9E826C76932|bdbA]-[gene|6B2DC9873B7B693D9D0FC0D773740140D0640C9E|yolJ]-[gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: activation, [Pubmed|20817675,19465659], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • expression starts in the stationary phase [pubmed|30808982]
  • expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] [pubmed|30808982]
  • additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE21440 ([gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTACATATCTTG, downstream forward: _UP4_TGAATAAGAAGTAACCCGCC
  • BKK21440 ([gene|12CE5AE0BD02C989E803480A1CE5A47D6192D751|bdbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTACATATCTTG, downstream forward: _UP4_TGAATAAGAAGTAACCCGCC
  • References

    Reviews

  • 25212246
  • Original publications

  • 27902860,11872755,15743949,20817675