SubtiBank SubtiBank
yvrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvrA

[SW|ABC transporter] (ATP binding domain) for cobalamin
locus
BSU_33160
pI
5.01
mw
48.47 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
uptake of cobalamin
product
[SW|ABC transporter] (ATP binding domain)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.7|Uptake of cofactors]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.13|Biosynthesis/ acquisition of cobalamine (B12))]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,401,141 3,402,469

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Structure

  • [PDB|4G1U] (from Yersinia pestis, N-terminal domain, aa 1 .. 255, 41% identity) [pubmed|23142986]
  • Expression and Regulation

    Operons

    genes
    [gene|C76265F521D9A153F28AC6BACD935CC20DEA5D9C|yvrC]-[gene|1DC4A3D7E93677B0EAD15F43C80E50FD98527EBC|yvrB]-[gene|128EBAE9C14C7BB75173DF912853A6FCE86ABCE4|yvrA]-[gene|468D9141EAC78556C9F6C564875F70EC43E60C1C|yvqK]

    regulatory mechanism

  • [regulon|B12 riboswitch|B12 riboswitch]: termination, upon binding of B12 [Pubmed|14704351], in [regulon|B12 riboswitch|B12 riboswitch]
  • regulation

  • expression is decreased in the presence of cobalamin (vitamin B12) ([SW|B12 riboswitch]) [Pubmed|14704351]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B043 (yvrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1042 NBRP B. subtilis, Japan]
  • BKE33160 ([gene|128EBAE9C14C7BB75173DF912853A6FCE86ABCE4|yvrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCCGACAGCCCTTCTGCCT, downstream forward: _UP4_TAAGTCTGTAAAGGAGATTC
  • BKK33160 ([gene|128EBAE9C14C7BB75173DF912853A6FCE86ABCE4|yvrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCCGACAGCCCTTCTGCCT, downstream forward: _UP4_TAAGTCTGTAAAGGAGATTC
  • References

  • 10092453,14704351,23142986