SubtiBank SubtiBank
yoyK/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoyK/2

part of the yoyK pseudogene
locus
BSU_21599
pI
0.00
mw
0.00 kDa
protein length
gene length
117 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    2,278,340 2,278,456

    Biological materials

    Mutant

  • BKE21599 ([gene|1289189B272EF1E53E8BEA38B92F533987B0867E|yoyK/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21599 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAGCTTCAAATGAATAAC, downstream forward: _UP4_TGACCTGATCAATTCCCAAA
  • BKK21599 ([gene|1289189B272EF1E53E8BEA38B92F533987B0867E|yoyK/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21599 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAGCTTCAAATGAATAAC, downstream forward: _UP4_TGACCTGATCAATTCCCAAA