SubtiBank SubtiBank
ligD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ligD

DNA repair polymerase/ ligase in non-homologous end joining DNA repair
locus
BSU_13400
pI
6.65
mw
70.03 kDa
protein length
611 aa Sequence Blast
gene length
1836 bp Sequence Blast
function
non-homologous end joining DNA repair, repair of gapped DNA substrates
product
DNA repair polymerase/ ligase
essential
no
synonyms
ykoU

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.3|Spore-encoded non-homologous end joining system]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,404,518 1,406,353

    Phenotypes of a mutant

  • sensitivity to ionizing radiation in the stationary phase [Pubmed|12215643]
  • sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]
  • a ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]'' double mutant is sensitive to radiation [Pubmed|24123749]
  • The protein

    Catalyzed reaction/ biological activity

  • has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination
  • has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain [Pubmed|26826709]
  • ATP + (deoxyribonucleotide)(n)-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)(m) --> (deoxyribonucleotide)(n+m) + AMP + diphosphate (according to UniProt)
  • Protein family

  • N-terminal part: LigD polymerase family (single member, according to UniProt)
  • C-terminal part: ATP-dependent DNA ligase family (with [protein|B66132676788FBA47D375193A1C01FC6F93E110F|LigB], according to UniProt)
  • [SW|Domains]

  • N-terminal DNA ligase catalytic domain (aa 1 - 331) linked to a C-terminal polymerase domain (aa 332 - 611) [Pubmed|23691176]
  • Structure

  • [PDB|6NHX] (N-terminal ligase domain, from Mycobacterium tuberculosis, 26.3% identity) [pubmed|30718283]
  • [PDB|5OP0] (C-terminal polymerase domain, from Mycobacterium smegmatis, 30% identity) [pubmed|29089537]
  • Expression and Regulation

    Operons

    genes
    [gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A778 (ykoU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/778 NBRP B. subtilis, Japan]
  • BP141 (''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
  • BP142 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
  • BKE13400 ([gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
  • BKK13400 ([gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
  • References

    Reviews

  • 17938628,22933559
  • Original publications

  • 16497325,23691176,12215643,11075926,11566200,17293412,24123749,24123749,25355514,26826709,26961308,15778718,16518468,29234047,30746801,30976810,30718283,29089537