SubtiBank SubtiBank
yqbA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqbA

similar to phage-related protein
locus
BSU_26180
pI
4.95
mw
58.29 kDa
protein length
510 aa Sequence Blast
gene length
1533 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    2,686,770 2,688,302

    The protein

    Protein family

  • phage portal family (with [protein|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|XkdE], according to UniProt)
  • Expression and Regulation

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE26180 ([gene|12661F79EA61EA386D73923234009C6E9BF62C31|yqbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAACAGATTTTTTTGACA, downstream forward: _UP4_GATGTTCTGGAGGATTTGAA
  • BKK26180 ([gene|12661F79EA61EA386D73923234009C6E9BF62C31|yqbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAACAGATTTTTTTGACA, downstream forward: _UP4_GATGTTCTGGAGGATTTGAA