SubtiBank SubtiBank
yqbA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbA

similar to phage-related protein
locus
BSU_26180
pI
4.95
mw
58.29 kDa
protein length
510 aa Sequence Blast
gene length
1533 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    2,686,770 2,688,302

    The protein

    Protein family

  • phage portal family (with [protein|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|XkdE], according to UniProt)
  • Expression and Regulation

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE26180 ([gene|12661F79EA61EA386D73923234009C6E9BF62C31|yqbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAACAGATTTTTTTGACA, downstream forward: _UP4_GATGTTCTGGAGGATTTGAA
  • BKK26180 ([gene|12661F79EA61EA386D73923234009C6E9BF62C31|yqbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAACAGATTTTTTTGACA, downstream forward: _UP4_GATGTTCTGGAGGATTTGAA