SubtiBank SubtiBank
acuC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

acuC

protein deacetylase for the control of [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] activity
locus
BSU_29710
pI
5.06
mw
42.83 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast
function
control of [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] activity
product
[protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] deacetylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.5|Protein acetylases/ deacetylases]
  • Gene

    Coordinates
    3,041,392 3,042,555

    The protein

    Catalyzed reaction/ biological activity

  • deacetylates (and thereby activates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] (together with [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|SrtN]) [Pubmed|19136592]
  • Protein family

  • histone deacetylase family (single member, according to UniProt)
  • Structure

  • [PDB|1C3R] (from Aquifex aeolicus, 35% identity) [pubmed|10490031]
  • Expression and Regulation

    Operons

    genes
    [gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]-[gene|FC9981CFB9D7EB8ACDA3032EC2F0538988F277AA|acuB]-[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]
    description
    [Pubmed|7934817]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7913927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7913927], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|7913927,12850135]
  • additional information

  • the mRNA is quite stable (half-life 5 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • GP1209 (''[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • GP1213 (''[gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]''::''cat'')(''[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • 1A887 ( ''acuC''::''spc''), [Pubmed|16855235], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A887&Search=1A887 BGSC]
  • BKE29710 ([gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATAGCAGATCCCTTTG, downstream forward: _UP4_CAAAGAACAAAGTAAAAAAC
  • BKK29710 ([gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATAGCAGATCCCTTTG, downstream forward: _UP4_CAAAGAACAAAGTAAAAAAC
  • References

  • 7913927,16855235,7934817,19136592,18487328,26098117,12884008,10490031