SubtiBank SubtiBank
yonP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yonP

unknown
locus
BSU_21030
pI
5.04
mw
7.41 kDa
protein length
gene length
195 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,222,340 2,222,534

    Expression and Regulation

    Operons

    genes
    [gene|121C3C9CF49711316A526B9571F020BE8E304B31|yonP]-[gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]-[gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE21030 ([gene|121C3C9CF49711316A526B9571F020BE8E304B31|yonP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTCACCTCCTCACT, downstream forward: _UP4_TAAATCAAAAAATATGCATA
  • BKK21030 ([gene|121C3C9CF49711316A526B9571F020BE8E304B31|yonP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTCACCTCCTCACT, downstream forward: _UP4_TAAATCAAAAAATATGCATA