SubtiBank SubtiBank
cheR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cheR

MCPs methyltransferase
locus
BSU_22720
pI
9.25
mw
29.80 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
motility, chemotaxis
product
MCPs methyltransferase
essential
no
ec
2.1.1.80
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.1|Soluble signalling proteins]
  • Gene

    Coordinates
    2,380,347 2,381,117

    The protein

    Catalyzed reaction/ biological activity

  • methylation of specific glutamate residues in the cytoplasmic domain of methyl-accepting chemotactic protein receptors (MCPRs)
  • L-glutamyl-[protein] + S-adenosyl-L-methionine --> [protein]-L-glutamate 5-O-methyl ester + S-adenosyl-L-homocysteine (according to UniProt)
  • [SW|Domains]

  • CheR-type methyltransferase domain (aa 1-256) (according to UniProt)
  • Structure

  • [PDB|5FTW] (complex with S-adenosyl-L-homocysteine)
  • Expression and Regulation

    Operons

    genes
    [gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]-[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • 1A830 ( ''cheR''::''cat''), [Pubmed|8244966], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A830&Search=1A830 BGSC]
  • BKE22720 ([gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTACTCTCCCAGTCT, downstream forward: _UP4_TAGACTGACTTTTTGCTGAA
  • BKK22720 ([gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTACTCTCCCAGTCT, downstream forward: _UP4_TAGACTGACTTTTTGCTGAA
  • References

    Reviews

  • 20122866
  • Original publications

  • 8866475,21515776,25799883,27544050