SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


MCPs methyltransferase
29.80 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
motility, chemotaxis
MCPs methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Soluble signalling proteins]
  • Gene

    2,380,347 2,381,117

    The protein

    Catalyzed reaction/ biological activity

  • methylation of specific glutamate residues in the cytoplasmic domain of methyl-accepting chemotactic protein receptors (MCPRs)
  • L-glutamyl-[protein] + S-adenosyl-L-methionine --> [protein]-L-glutamate 5-O-methyl ester + S-adenosyl-L-homocysteine (according to UniProt)
  • [SW|Domains]

  • CheR-type methyltransferase domain (aa 1-256) (according to UniProt)
  • Structure

  • [PDB|5FTW] (complex with S-adenosyl-L-homocysteine)
  • Expression and Regulation


    view in new tab

    Biological materials


  • 1A830 ( ''cheR''::''cat''), [Pubmed|8244966], available at [ BGSC]
  • BKE22720 ([gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTACTCTCCCAGTCT, downstream forward: _UP4_TAGACTGACTTTTTGCTGAA
  • BKK22720 ([gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTACTCTCCCAGTCT, downstream forward: _UP4_TAGACTGACTTTTTGCTGAA
  • References


  • 20122866
  • Original publications

  • 8866475,21515776,25799883,27544050