SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


homoserine O-succinyltransferase
25.85 kDa
protein length
301 aa Sequence Blast
gene length
906 bp Sequence Blast
biosynthesis of methionine
homoserine O-succinyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    2,305,378 2,306,283

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + L-homoserine --> CoA + O-acetyl-L-homoserine (according to UniProt)
  • Protein family

  • MetA family (single member, according to UniProt)
  • Structure

  • [PDB|2GHR] (from ''Bacillus cereus'', 60% identity, 77% similarity) [Pubmed|17546672]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials


  • BKE21910 ([gene|1217330ECD588E24E42FF9FED2A097CEF32785F3|metA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGCCACCTCCATTAT, downstream forward: _UP4_TAATTTTTCTTTTTTTAGTG
  • BKK21910 ([gene|1217330ECD588E24E42FF9FED2A097CEF32785F3|metA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGCCACCTCCATTAT, downstream forward: _UP4_TAATTTTTCTTTTTTTAGTG
  • References

  • 17546672,18179421,28581482