SubtiBank SubtiBank
argF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

argF

ornithine carbamoyltransferase
locus
BSU_11250
pI
4.97
mw
34.51 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
biosynthesis of arginine
product
ornithine carbamoyltransferase
essential
no
ec
2.1.3.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • Gene

    Coordinates
    1,203,461 1,204,420

    The protein

    Catalyzed reaction/ biological activity

  • carbamoyl phosphate + L-ornithine --> H+ + L-citrulline + phosphate (according to UniProt)
  • Protein family

  • ATCase/OTCase family (with [protein|B83462A50FDDD20FE9BD4681824E30AAD10F506B|PyrB], according to UniProt)
  • Structure

  • [PDB|2EF0] (from ''Thermus thermophilus hb8'', 48% identity, 63% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]-[gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]-[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]-[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]-[gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]-[gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]-[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]
    description
    [Pubmed|7511775]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • 1A605 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A605&Search=1A605 BGSC]
  • 1A606 ( ''argF''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A606&Search=1A606 BGSC]
  • BKE11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT, downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
  • BKK11250 ([gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCGTATAAACTGGTTT, downstream forward: _UP4_TGAGCCAAACTCAGCAGTTT
  • References

  • 6096675,24843172,12107147,1312212,7511775