SubtiBank SubtiBank
rplGB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rplGB

highly expressed protein, similar to ribosomal protein L7AE family, associated with the ribosome during exponential growth, binds K-turns in RNA switches
locus
BSU_01090
pI
9.51
mw
8.33 kDa
protein length
gene length
249 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ybaB,rpmXB,ktuS

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    129,340 129,588

    The protein

    Catalyzed reaction/ biological activity

  • binds K-turns in [SW|RNA switch]es as they occur in the [protein|search|L-box], the [protein|search|S-box] and the [protein|search|T-box] [Pubmed|22355167]
  • Protein family

  • Eukaryotic ribosomal protein eL8 family (with [protein|7BFA65857F69855DBB3BB64D93B4ED2F09DC705B|RplGA], according to UniProt)
  • Structure

  • [PDB|3V7E] ([protein|11D7ABA61FC4069B48614875AF2C6C694291B545|RplGB] bound to the [S-box|search|SAM-I riboswitch] aptamer) [Pubmed|22355167]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB]-[gene|0E4CB387626F53E5F60C7639D525B57D50C65C03|rpsL]-[gene|8049CACE85B2627A08CB4D8A8587D52E2DB24C7F|rpsG]-[gene|297844645CCCF40CB40E84339997F6610883DF4E|fusA]-[gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|tufA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB] and [gene|0E4CB387626F53E5F60C7639D525B57D50C65C03|rpsL] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE01090 ([gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACATATCCTCCAAAG, downstream forward: _UP4_TAACGTACTTTTGTTTTTGC
  • BKK01090 ([gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACATATCCTCCAAAG, downstream forward: _UP4_TAACGTACTTTTGTTTTTGC
  • References

  • 11948165,23249744,22355167,26522935,29280348,29794222